HERE'S A LIST OF SPECIFIC HUMAN LAMININ CHAIN PRIMER SEQUENCES FOR ANALYSIS OF TISSUE AND CELL-SPECIFIC GENE EXPRESION

Download the table

  

 

   GenBank

accession no.      

             5′ Primer

           3′ Primer

Amplicon

 size, bp         

Annealing

 temp, °C 

α1       

  NM_005559

GTCAGCGACTCAGAGTGTTTG

AACTTGGGTGAAAGATCGTCAG

    185

     55

α2

  NM_000426

GAACCCGCAGTGTCGAATCT

GGGGAGTTAGCTGCCTTCA

    204

     55

α3

  NM_000227

TAGACTTTGGAAGCACCTACTCA     

GTTTATCAAGGACACCACAACCT     

    185

     55

α4

  NM_002290

GCAGTGGAAATTCAGATCCCA

TAACCGCAGGTCATCAGTCAG

    275

     55

α5

  NM_005560

GGTGTGTCTCTGCGTGACAA

CCCCGACGTAGAAGACGAA

    253

     55

β1

  NM_002291

AGGAACCCGAGTTCAGCTAC

CACGTCGAGGTCACCGAAA

    103

     55

β2

  NM_002292

GCCCTGGGAACTTCGACTG

GGAAGCACTTCTTTTCGTCCTG

    227

     55

β3

  NM_000228

TCCTCTTGTGTTTTGCCCTG

CTGCCTGGAGTCACACTTG

    206

     55

γ1

  NM_002293

TCGTCAACGCCGCCTTCAA

GTGTCGGCCTGGTTGTTGTA

    184

     55

γ2

  NM_005562

CCAGGAGGGAAGTCTGTGATT

GCAGTGAATCCCATCAGTGTT

    128

     55

γ3

  NM_006059

CCAGGTGCATCACATCCTGAG

GACCCCATTTGGGCTCCATT

    236

     55